View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11188_low_7 (Length: 241)
Name: NF11188_low_7
Description: NF11188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11188_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 49376299 - 49376106
Alignment:
| Q |
13 |
cacagatggggcacaagtatctgcgattataatactcaaaacaaccaaacatttgaaatttgtatagatgtgttccttcactaatctaactaatcatctt |
112 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49376299 |
cacaaatggggcacaagtatatgcgattataatactcaaaacaaccaaacatttgaaatttgtatagatgtgttgcttcactaatctaactaatcatctt |
49376200 |
T |
 |
| Q |
113 |
aaaaggaacatatatattcttcatcatacaggatatcatctnnnnnnnntaaccaagttacgagtaagttggatttgattgcatcttttcaacc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49376199 |
aaaaggaacatatatattcttcatcatacaagatatcatctaaaaaaaataaccaagttacgagtaagttgcatttgattgcatcttttcaacc |
49376106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University