View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11190_low_12 (Length: 349)
Name: NF11190_low_12
Description: NF11190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11190_low_12 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 11 - 349
Target Start/End: Complemental strand, 14171525 - 14171187
Alignment:
| Q |
11 |
agcagagagtatataattaagttcaacctttttctcaaccattaaaccatgcacccacttcgcattacaaaatgaaccgagacgtgcacaccccgtcacc |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14171525 |
agcagtgagtatataattaagttcaacctttttctcaaccattaaaccatgcacccacttcgcattacaaaatgaaccgagacgtgcacaccccgtcacc |
14171426 |
T |
|
| Q |
111 |
acagaagcaaaagtaaacccatccggctcaaccttggccttcaacatgacgcggaaaatactcaatgcattaagaaatcgcaaatttttaacataccctc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
14171425 |
acagaagcaaaagtaaacccatccggctcaaccttggccttcaacatgacgcggaaaatactcaatgcatcaagaaagcgcaaatttttaacataccctc |
14171326 |
T |
|
| Q |
211 |
caatgacagtgttccaagtaacaacatctcgaacaggcattttatcaaacaccttcttggcaatatcacattccccagatttcactaggctttcaatcac |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14171325 |
caatgacagtgttccaagtaacaacatctcgaacaggcattttatcaaacaccttcttggcaatatcacattccccagatttcactaggctttcaatcac |
14171226 |
T |
|
| Q |
311 |
caaattcatgttgaacagattcataactctggtaaacac |
349 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| |||||| |
|
|
| T |
14171225 |
caaattcatgttgaacaaattcataaccctggaaaacac |
14171187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 219 - 261
Target Start/End: Complemental strand, 40655727 - 40655685
Alignment:
| Q |
219 |
gtgttccaagtaacaacatctcgaacaggcattttatcaaaca |
261 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
40655727 |
gtgttccaactaacaacatctctaacaggcatttcatcaaaca |
40655685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University