View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11191_high_15 (Length: 241)
Name: NF11191_high_15
Description: NF11191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11191_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 27 - 217
Target Start/End: Original strand, 4546697 - 4546883
Alignment:
| Q |
27 |
ccaacaccaatccactcaaagaaacttcaatttacaaacaaaacaagagagcagcggttcttatttgtttattcgaaggtcaagatgggaatttgcgtgt |
126 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4546697 |
ccaacaccaatccactaaaagaaacttcaatttacaaacaaaacaagagagcagcggttcttatttgtttattcgaaggtcaagatgggaatttgcgtgt |
4546796 |
T |
 |
| Q |
127 |
tattcttacacaacgtgcttcttctctctcaacccacgccggttagtttcgtctcgtgtctgacatgtgtgatgtgattactttcaattaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
4546797 |
tattcttacacaacgtgcttcttctctctcaacccacgccggttagtttagtttcgtgtctgacatgtgtgat----ttactttcaattaa |
4546883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University