View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11191_low_15 (Length: 249)
Name: NF11191_low_15
Description: NF11191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11191_low_15 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 24045804 - 24046041
Alignment:
| Q |
12 |
atgaagaagataagtgggaccaatagtatcacaaaccattacgaaccttacaatctcttttccttcagtaccttacaacacaatccatccatgcaactca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24045804 |
atgaagaagataagtgggaccaatagtatcacaaaccattacgaaccttacaatctcttttccttcagtaccttacaacacaatccatccatgcaactca |
24045903 |
T |
|
| Q |
112 |
ttcacccctagaaacacactagtgcaaatttcaacaaaaatggttgcaatggcagcagcaacagcatcatcacaattaatattctcaaaaccttgttctc |
211 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24045904 |
ttcaccactagaaacacactagtgcaaatttcaacaaaaatggttgcaatggcagcagcaacagcatcatcacaattaatattctcaaaaccttgttctc |
24046003 |
T |
|
| Q |
212 |
cctcacgtctatgtcccttccaactttgtgttttcgac |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24046004 |
cctcacgtctatgtcccttccaactttgtgttttcgac |
24046041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University