View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11191_low_16 (Length: 241)

Name: NF11191_low_16
Description: NF11191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11191_low_16
NF11191_low_16
[»] chr2 (1 HSPs)
chr2 (27-217)||(4546697-4546883)


Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 27 - 217
Target Start/End: Original strand, 4546697 - 4546883
Alignment:
27 ccaacaccaatccactcaaagaaacttcaatttacaaacaaaacaagagagcagcggttcttatttgtttattcgaaggtcaagatgggaatttgcgtgt 126  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4546697 ccaacaccaatccactaaaagaaacttcaatttacaaacaaaacaagagagcagcggttcttatttgtttattcgaaggtcaagatgggaatttgcgtgt 4546796  T
127 tattcttacacaacgtgcttcttctctctcaacccacgccggttagtttcgtctcgtgtctgacatgtgtgatgtgattactttcaattaa 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||    ||||||||||||||    
4546797 tattcttacacaacgtgcttcttctctctcaacccacgccggttagtttagtttcgtgtctgacatgtgtgat----ttactttcaattaa 4546883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University