View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11191_low_18 (Length: 211)
Name: NF11191_low_18
Description: NF11191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11191_low_18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 42605648 - 42605858
Alignment:
| Q |
1 |
attcgttttaacaacagttactcgctgctattccactagaaaattacgaaaaactggttcttccaagttgcacaaggttgaagctgaaacgaccatgaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42605648 |
attcgttttaacaacagttactcgctgctattccactagaaaattacgaaaaactggttcttccaagttgcacaaggttgaagctgaaacgacaatgaat |
42605747 |
T |
 |
| Q |
101 |
caggaacaaaatgaaagtgatgctttttatgttgtaaggaaaggggatgttgttggaatttataatactctcactgattcccaagctcaagttggatctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42605748 |
caggaacaaaatgaaagtgatgctttttatgttgtaaggaaaggggatgttgttggaatttataatactctcactgattcccaagctcaagttggatctt |
42605847 |
T |
 |
| Q |
201 |
cggtaattctt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
42605848 |
cggtaattctt |
42605858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 81 - 201
Target Start/End: Original strand, 41029945 - 41030065
Alignment:
| Q |
81 |
aagctgaaacgaccatgaatcaggaacaaaatgaaagtgatgctttttatgttgtaaggaaaggggatgttgttggaatttataatactctcactgattc |
180 |
Q |
| |
|
|||||||||| | ||| ||||| || |||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41029945 |
aagctgaaacaaggatggatcagcaagaaaatgaaagggatggtttttatgttgtgaggaaaggggatgttgttggaatttataatactctcactcattc |
41030044 |
T |
 |
| Q |
181 |
ccaagctcaagttggatcttc |
201 |
Q |
| |
|
|| ||||||| ||||||||| |
|
|
| T |
41030045 |
tcaggctcaagctggatcttc |
41030065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 1757104 - 1757050
Alignment:
| Q |
18 |
ttactcgctgctattccactagaaaattacgaaaaactggttcttccaagttgca |
72 |
Q |
| |
|
||||||| || |||||||||||||||||||| |||| ||||||||| ||||||| |
|
|
| T |
1757104 |
ttactcgatgatattccactagaaaattacggaaaagtggttcttcgtagttgca |
1757050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University