View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11192_low_10 (Length: 295)
Name: NF11192_low_10
Description: NF11192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11192_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 17 - 280
Target Start/End: Complemental strand, 27423914 - 27423651
Alignment:
| Q |
17 |
cacagaacaccctattaccaacaaaagctaaggtaaaccctttttccaatacactttgtgtgtaaccccctgacaaaaaatctccataagcattcatcaa |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27423914 |
cacaaaacaccctattaccaacaaaagctaaggtaaaccctttttccaatacactttgtgtgtaaccccctgacaaaaaatctccataagcattcatcaa |
27423815 |
T |
 |
| Q |
117 |
aaaatttgcatcaattagaaatcctatggccattgagctgcataagaaactaatcaacaaacaaattgatgctgaaccatacttcaaaaggaagattgta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
27423814 |
aaaatttgcatcaattagaaatcctatggccattgagctgcataagaaactaatcaacaaacaaattgatgctgaagcatatttcaaaaggaagattgtg |
27423715 |
T |
 |
| Q |
217 |
tctgattttgaaccaaaaaatccactactaaaaagatggcttgcattgaatgcattgttgttta |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27423714 |
tctgattttgaaccaaaaaatccactactaaaaagatggcttgcattgaatgcattgttgttta |
27423651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University