View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11192_low_13 (Length: 249)
Name: NF11192_low_13
Description: NF11192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11192_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 42873221 - 42872977
Alignment:
| Q |
1 |
aattatatagtatatatttgtcttggattcttagacatgcctcatgattatgcatatcctgactagttaacaaaaggaatattgaactagagaaaattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42873221 |
aattatatagtatatatttgtcttggattcttagacatgcctcatgattatgcatatcctgactagttaacaaaaggaatattgaactagagaaaattaa |
42873122 |
T |
 |
| Q |
101 |
----------tagttcccgcaccactgtttggtaactcagagatgccaccacatgatggcttcagaaagagatccttggctccattggtttattaatcaa |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42873121 |
agaaaattaatagttcccgcaccactgtttggtaactcagagatgccaccacatgatggcttcagaaagagatccttggctccattggtttattaatcaa |
42873022 |
T |
 |
| Q |
191 |
tcaaaccaaattgctttaaacgcaaaatatggatatacttataat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42873021 |
tcaaaccaaattgctttaaacgcaaaatctggatatacttataat |
42872977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University