View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11192_low_14 (Length: 248)
Name: NF11192_low_14
Description: NF11192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11192_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 42873267 - 42873432
Alignment:
| Q |
1 |
tgctagcacatttaaaaatagagatttttaaatcattgttgata----atatgaaaagtaatcatggttatgtatagagttatgnnnnnnnnnnngggta |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
42873267 |
tgctagcacatttaaaaatagagatttttaaatcattgttgatatataatatgaaaagtaatcatggttatgtatag--ttatgttttttttttttggta |
42873364 |
T |
 |
| Q |
97 |
caatgtatggagttgtgttatttttaaaccaaaatttatacaaacagatatgacacggtataactcta |
164 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42873365 |
caatgtatggagttgtgttattttcaaaccaaaatttatacaaacagatatgatacggtataactcta |
42873432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University