View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11192_low_19 (Length: 221)
Name: NF11192_low_19
Description: NF11192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11192_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 22 - 207
Target Start/End: Complemental strand, 50372369 - 50372184
Alignment:
| Q |
22 |
ataatggagctattagaggaagatgctacattcgctaatgtgtgaacgattccattaatctgtctccgtctaatttgattatgaagttttgaaatgtaat |
121 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50372369 |
ataatggagctattataggatgatgctacattcgttaatgtgtgaacgatcccattaatttgtctccgtctaatttgattatgaagttttgaaatgtaat |
50372270 |
T |
 |
| Q |
122 |
ttggaacaactacttacaaacatacattaatttaattatatcacattcttactagcggaacgcccatcaaccataatgtccctttg |
207 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
50372269 |
ttggaacaactatttacagacatacattaatttaattatatcacattcttactagcggaacgcccatcaaccacaatgtccctttg |
50372184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 159 - 203
Target Start/End: Complemental strand, 33880398 - 33880354
Alignment:
| Q |
159 |
atatcacattcttactagcggaacgcccatcaaccataatgtccc |
203 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
33880398 |
atatcacattcttaccagcggaacgcccatcaaccctaatgtccc |
33880354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University