View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11193_high_12 (Length: 284)
Name: NF11193_high_12
Description: NF11193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11193_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 43 - 275
Target Start/End: Complemental strand, 28672769 - 28672544
Alignment:
| Q |
43 |
tcttccataattgacaaccatggtctcggtctcatgggtgctggtcaattttccgtaaaggtttatgcattagacactatcatgggcgaggttggattac |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28672769 |
tcttccataattgacaaccatggtctcggtctcatgggtgctggtcaattttccgtaaaggtttatgcattagacactatcatgggcgaggttggattac |
28672670 |
T |
 |
| Q |
143 |
aaggtcgaatctggtgggcatcctgggccgcacgggtgatgctcatttaccgttgctcgcagagccggccgagaaggattattggtatatggtggtaact |
242 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
28672669 |
agggtcgaatctggtgggcatcctgggccgcacgggtggtgctcatttaccattgctcgcagagccggctgagaaggattattggtatatggtagta--- |
28672573 |
T |
 |
| Q |
243 |
gtcctagtgtcttgatgacattttcttctctgc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28672572 |
----tagtgtcttgatgacattttcttctctgc |
28672544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 28672860 - 28672824
Alignment:
| Q |
1 |
gtttgtttattcacaatcttggattttagcttgcaac |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28672860 |
gtttgtttattcacaatcttggattttagcttgcaac |
28672824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University