View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11193_high_6 (Length: 393)
Name: NF11193_high_6
Description: NF11193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11193_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 37322836 - 37322803
Alignment:
| Q |
18 |
atctactctaaatttttcacttacaaaattcatt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
37322836 |
atctactctaaatttttcacttacaaaattcatt |
37322803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University