View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11193_high_8 (Length: 357)
Name: NF11193_high_8
Description: NF11193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11193_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 17 - 278
Target Start/End: Complemental strand, 24500208 - 24499944
Alignment:
| Q |
17 |
catttatttaatttaatagaaattgaaatagtattggttgaatcaacgcattttgtttcacaacataatta--tttcattcatcctaaaaaattgaatat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24500208 |
catttatttaatttaatagaaattgaaatagtattggttgaatcaacgcattttgtttcacaacataattatctttcattcatcctaaaaaattgaatat |
24500109 |
T |
 |
| Q |
115 |
attgaaaatattcaatatgtacaattcacaacatgattgtgaatttcgnnnnnnngcaggtttacatgattgtctgaatgatccgtggcggatggttcca |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24500108 |
attgacaatattcaatatgtacaattcacaacatgattgtgaatttcgtttttttgcaggtttacatgattgtctgaatgatccgtggcggatggttcca |
24500009 |
T |
 |
| Q |
215 |
gagttaattcc-gcaatttttgttgatgaatctaccttagtgaatctgtgaagattaaagaatag |
278 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24500008 |
gagttaattcctgcaatttttgttgatgaatctaccttagtgaatctgtgaagattaaagaatag |
24499944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University