View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11193_low_6 (Length: 393)

Name: NF11193_low_6
Description: NF11193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11193_low_6
NF11193_low_6
[»] chr2 (1 HSPs)
chr2 (18-51)||(37322803-37322836)


Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 37322836 - 37322803
Alignment:
18 atctactctaaatttttcacttacaaaattcatt 51  Q
    ||||||||||||||||||||||||||||||||||    
37322836 atctactctaaatttttcacttacaaaattcatt 37322803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University