View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11194_low_2 (Length: 217)
Name: NF11194_low_2
Description: NF11194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11194_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 14201307 - 14201506
Alignment:
| Q |
1 |
taattattgtaactaactattacatctaataatactgaccggagaattgtatagagcgatcaacggagagaacgcgattatggccaccgaggtaacggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14201307 |
taattattgtaactaactattacatctaataatactgaccggagaattgtatagagcgatcaacggagagaacgcgattatggccaccgaggtaacggag |
14201406 |
T |
 |
| Q |
101 |
tttgccatccgggtaacgggggaggattttgccaccatagctacagaggaatttgatggtggatttgggagaacccgaagcgggttcagagagtccgatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14201407 |
tttgccatccgggtaacgggggaggattttgccaccatagctacagaggaatttgatggtggatttgggagaacccgaagcgggttcagagagtccgatc |
14201506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 37701781 - 37701816
Alignment:
| Q |
1 |
taattattgtaactaactattacatctaataatact |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37701781 |
taattattgtaactaactattacaactaataatact |
37701816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 29051319 - 29051289
Alignment:
| Q |
1 |
taattattgtaactaactattacatctaata |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29051319 |
taattattgtaactaactattacatctaata |
29051289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 32
Target Start/End: Original strand, 42603678 - 42603706
Alignment:
| Q |
4 |
ttattgtaactaactattacatctaataa |
32 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42603678 |
ttattgtaactaactattacatctaataa |
42603706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University