View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11195_low_21 (Length: 224)
Name: NF11195_low_21
Description: NF11195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11195_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 208
Target Start/End: Original strand, 37887559 - 37887746
Alignment:
| Q |
15 |
agagaccggttaagctctccctatcggagatcgaagcagcaaaatttctcgtacaactcagcagcggagatttcgaagaagatcaaaacagcaataacaa |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37887559 |
agaggccggttaagctctccctatcggagatcgaagcagcaaaatttctcgtacaactcagcagcggagatttcgaagaagatcaaaacagcaataa--- |
37887655 |
T |
 |
| Q |
115 |
cagcaatagcaatagctatagcgtgagtcacaacaaggttgattccggtggtgatgctgtatcatcatctactgttttgtcagattctgaaagt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37887656 |
---caatagcaatagctatagcgtgagtcacaacaaggttgattccggtggtgatgttgtatcatcatctactgttttgtcagattctgaaagt |
37887746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University