View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11197_high_3 (Length: 367)
Name: NF11197_high_3
Description: NF11197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11197_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 17 - 355
Target Start/End: Original strand, 7542224 - 7542562
Alignment:
| Q |
17 |
ataaacaaggacaaccttctaattaacatcaccttctcaatgttcatacattaattaaagatgatttagccttttgactataaccctcttccttaatttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542224 |
ataaacaaggacaaccttctaattaacatcaccttctcaatgttcatacattaattaaagatgatttagccttttgactataaccctcttccttaatttt |
7542323 |
T |
|
| Q |
117 |
ctctcatcaaattcttcacttgtctcaatctcacactaatcaaatgaaacaacctgctgcaaaatcatcattaaggaggttatgtccaaacatagacaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542324 |
ctctcatcaaattcttcacttgtctcaatctcacactaatcaaatgaaacaacctgctgcaaaatcatcattaaggaggttatgtccaaacatagacaaa |
7542423 |
T |
|
| Q |
217 |
gaagatggattggaaactgttcttgaaatacctatacctgaagaaatgttttcaaacatgggaagtaatgtgacattaagatggcaaaatatgttaacat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542424 |
gaagatggattggaaactgttcttgaaatacctatacctgaagaaatgttttcaaacatgggaagtaatgtgacattaagatggcaaaatatgttaacat |
7542523 |
T |
|
| Q |
317 |
ggatgaaggctcaaactgaggataaattgtcttccccta |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542524 |
ggatgaaggctcaaactgaggataaattgtcttccccta |
7542562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University