View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11199_high_8 (Length: 250)
Name: NF11199_high_8
Description: NF11199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11199_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 8474621 - 8474851
Alignment:
| Q |
1 |
cttaagtcttgtacggttctagcgcaggaaaatgtctcagcgaatgattgtaatagaatgtatttaatcaaactattataagtattattatagtttctgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8474621 |
cttaagtcttgtacggttctagcgcaggaaaatgtctcagcgaatgattgtaatagaatgtatttaatcaaactattataagtattattatagtttctgt |
8474720 |
T |
 |
| Q |
101 |
agcaggagattttgaaacctgaagataatttccataagtagcaacattgttttactaaatagaggatatagaaaacattgtttccatcgatgtttagagg |
200 |
Q |
| |
|
||||||| |||||||||||||||||| |||| |||||||||||| ||| ||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
8474721 |
agcaggaaattttgaaacctgaagatgattttcataagtagcaaaattattttactaaatagtg----------acattgtttccatcgatgtttagagg |
8474810 |
T |
 |
| Q |
201 |
attttgcctctttagggaaatgaacatgtgttccctctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8474811 |
attttgcctctttagggaaatgaacatgtgttccctctctg |
8474851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 61
Target Start/End: Original strand, 8484420 - 8484453
Alignment:
| Q |
28 |
gaaaatgtctcagcgaatgattgtaatagaatgt |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8484420 |
gaaaatgtctcagcgaatgattgtaatagaatgt |
8484453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University