View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11199_low_9 (Length: 204)
Name: NF11199_low_9
Description: NF11199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11199_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 43 - 200
Target Start/End: Original strand, 41631270 - 41631427
Alignment:
| Q |
43 |
tcaaaataaatatgtaaataaattgatcactatctctctcttcattattgacttcttttctgtctgtattggtttgttgagttcatattgttttaagcgt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41631270 |
tcaaaataaatatgtaaataaattgatcactatctctctcttcattattgacttcttttctgtctgtattggtttgttgagttcatattgttttaagcgt |
41631369 |
T |
|
| Q |
143 |
gaagcatgaaagcaatgattccaaagaaggagtcagaaacggttaatgatgaaagaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41631370 |
gaagcatgaaagcaatgattccaaagaaggagtcagaaacggttaatgatgaaagaag |
41631427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University