View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1119_high_14 (Length: 273)
Name: NF1119_high_14
Description: NF1119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1119_high_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 61 - 267
Target Start/End: Original strand, 13147843 - 13148049
Alignment:
| Q |
61 |
tcaatttcgacttgttgagatttattaaatttgtttactttttgtcttctcaaaaacataccgatctcactcgattcatcttgagatattctagtttatt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13147843 |
tcaatttcgacttgttgagatttattaaatttatttaccttttgtcttctcaaaaacataccgatctcactcgattcatcttgagatattctagtttatt |
13147942 |
T |
|
| Q |
161 |
catgtaactcatgcacattttgagagaatacgaaactttgcaatctatgcttgctttcctgtaaattaattgaagaacttgatggaaaaatttcaaactc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13147943 |
catgtaactcatgcacattttgagagaatacgaaactttgcaatatatgcttgctttcctgtaaattaattgaagaacttgatggaaaaatttcaaactc |
13148042 |
T |
|
| Q |
261 |
agagttc |
267 |
Q |
| |
|
||||||| |
|
|
| T |
13148043 |
agagttc |
13148049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 64
Target Start/End: Original strand, 38625367 - 38625418
Alignment:
| Q |
13 |
aatatggagacacaaatttggcaactagctnnnnnnnttgttgcccagtcaa |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38625367 |
aatatggagacacaaatttggcaactagctaaaaaaattgttgcccagtcaa |
38625418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University