View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1119_high_19 (Length: 253)
Name: NF1119_high_19
Description: NF1119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1119_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 30275288 - 30275533
Alignment:
| Q |
1 |
tgacaaattggccaaaatagaaacctgttgtctaagtgactcaggtaacttgattctagaactatcttgctccgttgcacttgtttcataagtaagggct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30275288 |
tgacaaattggccaaaatagaaacctgttgtgtaagtgactcaggtaacttgattctagaactatcttgctccgttgcacttgtttcataagtaagggct |
30275387 |
T |
|
| Q |
101 |
ctttcaagtatgataatatactcattaaagagatttttgagtccgctaataactaaatttcccatttcaagttcaactaatggagaaatgtcttctgcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30275388 |
ctttcaagtatgataatatactcattaaagagattcttgagtccgctaataactaaatttcccatttcaagttcaactaatggagaaatgtcttctgcaa |
30275487 |
T |
|
| Q |
201 |
tggcctgattattgtcaatcaa--atatgttatgtcctagtattat |
244 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30275488 |
tggcctgattattgtcaatcaaatatatgttatgtcctagtattat |
30275533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 96 - 244
Target Start/End: Original strand, 7778693 - 7778844
Alignment:
| Q |
96 |
gggctctttcaagtatgataatatactcatta---aagagattt-ttgagtccgctaataactaaatttcccatttcaagttcaactaatggagaaatgt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||| ||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7778693 |
gggctctttcaagtatgataatatactcattattaaagagattccttgagtccactaatgactaaatttcc-atttcaagttcaactaatggagaaatgt |
7778791 |
T |
|
| Q |
192 |
cttctgcaatggcctgattattgtcaatcaaatatgttatgtcctagtattat |
244 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7778792 |
cttctgcaacggcctgattattgtcaatcaaatatgttatgtactagtattat |
7778844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University