View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1119_high_2 (Length: 593)
Name: NF1119_high_2
Description: NF1119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1119_high_2 |
 | |
|
| [»] scaffold0856 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0856 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 320 - 539
Target Start/End: Original strand, 3491 - 3710
Alignment:
| Q |
320 |
atttgttacagacagaataattaggataagataacacaattccgaattacagatgaaagataagagatttagaaaatctacaaatttaaatcaagatatc |
419 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3491 |
atttgctacagacagaataattaggataagataacacaattccgaattacagatgaaagataagagatttagaaaatctacaaatttaaatcaagatatc |
3590 |
T |
|
| Q |
420 |
atgctatcggtcggagacaatttcaaactggctatgatcattccttaactgcccctctcaagctagaggatggtttgactactcctagcttgttccttag |
519 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3591 |
atgctatcggtcggagacaatttcaaactggctatgatcattccttaactgcccctctcaagctagaggatggtttgactactcctagcttgttccttag |
3690 |
T |
|
| Q |
520 |
ctgactaaacttcgtggttg |
539 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
3691 |
ctgactaaacttcatggttg |
3710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0856; HSP #2
Raw Score: 177; E-Value: 4e-95
Query Start/End: Original strand, 99 - 279
Target Start/End: Original strand, 3317 - 3497
Alignment:
| Q |
99 |
catttcactttgtttcataagaagggatctttcaatttcaaatatgataatatactcaatgaagaggttcctaagtccactcactaacggacttcccatt |
198 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3317 |
cattgcactttgtttcataagaagggatctttcaatttcaaatatgataatatactcaatgaagaggttcctaagtccactcactaacggacttcccatt |
3416 |
T |
|
| Q |
199 |
tcaagggcaactaaaggagtaatatattctacaagatagaaaaaactgaaggctggattaatcatataaatgctatttgct |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3417 |
tcaagggcaactaaaggagtaatatattctacaagatagaaaaaactgaaggctggattaatcatataaatgctatttgct |
3497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0856; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 535 - 583
Target Start/End: Original strand, 3748 - 3796
Alignment:
| Q |
535 |
ggttggaccataggctatagtcacgttattactcaacaactgatctctg |
583 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3748 |
ggttggaccataggctatagtcgcgttattactcaacaactgatctctg |
3796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University