View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1119_high_9 (Length: 324)
Name: NF1119_high_9
Description: NF1119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1119_high_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 16 - 324
Target Start/End: Complemental strand, 47782750 - 47782441
Alignment:
| Q |
16 |
atcaaaggatatagcattacatatgggtgtcctagatatatgctatattctttccggccggtagcacacaacacttgcatcaaatttggtggcatcaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47782750 |
atcaaaggatatagcattacatatggatgtcctagatatatgctatattctttccggccggtagcacacaacacttgcatcaaatttggtggcataaaaa |
47782651 |
T |
 |
| Q |
116 |
atggtccatgcaaacaatagtcatatttggtggtatatttaccactttagctggaatgtcatattctcgtgtcctctttaattacttgaaactttgagcg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47782650 |
atggtccatgcaaacaatagtcatatttggtggtatatttaccactttagctggaatgtcatattctcgtgtcctctttaattacttgaaactttgagcg |
47782551 |
T |
 |
| Q |
216 |
ggtgctcaactttgcgtctggctcacaaagatagaaaattgcatttgcacc-nnnnnnngatagaaaatggattggactaaaatacgtcgcccattgccg |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | || ||| |
|
|
| T |
47782550 |
ggtgctcaactttgcgtctggctcacaaagatagaaaattgcatttgcaccaaaaaaaagatagaaaatggattggactaaaatacgtcgctcgttaccg |
47782451 |
T |
 |
| Q |
315 |
gaatagatct |
324 |
Q |
| |
|
|||||||||| |
|
|
| T |
47782450 |
gaatagatct |
47782441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University