View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1119_low_14 (Length: 303)
Name: NF1119_low_14
Description: NF1119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1119_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 16 - 162
Target Start/End: Complemental strand, 36761984 - 36761837
Alignment:
| Q |
16 |
atgcccattaaattgagaagatccttattctacacattgccaccgnnnnnnn-tgtttccagaaattttgtattaggcaaagtttgtgcagtgacctaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36761984 |
atgcccattaaattgagaagatccttattgtacacattgccaccgaaaaaaaatgtttccagaaattttgtattaggcaaagtttgtgcagtgacctaaa |
36761885 |
T |
|
| Q |
115 |
tatttcccaagctagtaaaaaatcatcattgggttacttgtgtttttt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36761884 |
tatttcccaagctagtaaaaaatcatcattgggttacttgtgtttttt |
36761837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University