View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1119_low_18 (Length: 288)
Name: NF1119_low_18
Description: NF1119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1119_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 47 - 280
Target Start/End: Complemental strand, 32017310 - 32017077
Alignment:
| Q |
47 |
gcagaaaacaacactccccgcannnnnnnaagacagcagcactactacagatagcagaacagccgcataggggaaaacaccaacaaaacctgctgtgaac |
146 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32017310 |
gcagtaaacaacactccccgcacccccccaagacagcagcactactacagatagcagaacagccgcataggggaaaaaaccaacaaaacctgctgtgaac |
32017211 |
T |
|
| Q |
147 |
caacccagagagcacagctcgaaaaacacagaccctccccccttaaatactaccttcttaagcaatcttcaggatcccaattccactagtaaaataggca |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32017210 |
caacccagagagcacagctcgaaaaacacagaccctccccccttaaatactaccttcttaagcaatcttcaggatcccaattccactcgtaaaataggca |
32017111 |
T |
|
| Q |
247 |
aggcaaaaccttcaatctcatcaacattcatctc |
280 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
32017110 |
aggcaaaaccttcaatctcatcaacatccatctc |
32017077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University