View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1119_low_22 (Length: 274)
Name: NF1119_low_22
Description: NF1119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1119_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 30934607 - 30934834
Alignment:
| Q |
17 |
acttgtaatgagtaaccgatgaacattgaaggagttgataggcaaagagggttgcctttgagtgaaacgatcaagatagacatatgcaacaatgaaacag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30934607 |
acttgtaatgagtaaccgatgaacattgaaggagttgataggcaaagagggttgtctttgagtgaaacgatcaagatagacatatgcaacaatgaaacag |
30934706 |
T |
 |
| Q |
117 |
gatggactacaattggcatacttgaaaattctctcaaggtagttctgaattgagatattgggacaagtcaagccttgaaaaactgagatcttctgttgta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30934707 |
gatggactacaattggcatacttgaaaattctctcaaggtagttctgaattgagatattgggacaagtcaagccttgaaaaactgagatcttctgttcta |
30934806 |
T |
 |
| Q |
217 |
ggagttgctggttaatatcatttgattc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30934807 |
ggagttgctggttaatatcatttgattc |
30934834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 33 - 172
Target Start/End: Complemental strand, 1500327 - 1500188
Alignment:
| Q |
33 |
cgatgaacattgaaggagttgataggcaaagagggttgcctttgagtgaaacgatcaagatagacatatgcaacaatgaaacaggatggactacaattgg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||| ||||||||||| || || | ||||||||| | |
|
|
| T |
1500327 |
cgatgaacattgaaggagttgataggcaaagaaggttgagtttgagtgaaacgatcaaggtagacataagcaacaatgaagcatgaagaactacaatttg |
1500228 |
T |
 |
| Q |
133 |
catacttgaaaattctctcaaggtagttctgaattgagat |
172 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||||||||||| |
|
|
| T |
1500227 |
catacttgaaaattctctcaagatagctttgaattgagat |
1500188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University