View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1119_low_26 (Length: 260)
Name: NF1119_low_26
Description: NF1119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1119_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 24 - 223
Target Start/End: Original strand, 25342559 - 25342758
Alignment:
| Q |
24 |
atgcacggtgcatgcattcaccacataaaataaatgcacatgttgttcaattgttttggagtaagggatgttaatggttttcattggatttacactgaac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25342559 |
atgcacggtgcatgcattcaccacataaaataaatgcacatgttgttcaattgttttggagtaagggatgttaatggttttcattggatttacactgaac |
25342658 |
T |
 |
| Q |
124 |
ctgtttttagtgtgtgtagtttcttagccgacaattatacggactaaagaaagggacttccataaccaaaatcgtttcagaaaagtggagtcatatatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |||| ||| ||||| |||||||||||||||| |
|
|
| T |
25342659 |
ctgtttttagtgtgtgtagtttcttagccgacagtaatacggactaaagaaagggacttccataaccagaatcattttagaaaggtggagtcatatatgt |
25342758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University