View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1119_low_27 (Length: 260)
Name: NF1119_low_27
Description: NF1119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1119_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 25342549 - 25342758
Alignment:
| Q |
14 |
ctccaacaaaatgcacggtgcatgcattcaccacataaaataaatgcacatgttgttcaattgttttggagtaagggatgttaatggttttcattggatt |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25342549 |
ctccaacataatgcacggtgcatgcattcaccacataaaataaatgcacatgttgttcaattgttttggagtaagggatgttaatggttttcattggatt |
25342648 |
T |
 |
| Q |
114 |
tacactgaacctgtttttagtgtgtgtagtttcttagccgacaattatacggactaaagaaagggacttccataaccaaaatcgtttcagaaaagtggag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |||| ||| ||||| |||||| |
|
|
| T |
25342649 |
tacactgaacctgtttttagtgtgtgtagtttcttagccgacagtaatacggactaaagaaagggacttccataaccagaatcattttagaaaggtggag |
25342748 |
T |
 |
| Q |
214 |
tcatatatgt |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
25342749 |
tcatatatgt |
25342758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University