View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1119_low_31 (Length: 251)
Name: NF1119_low_31
Description: NF1119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1119_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 130
Target Start/End: Complemental strand, 30952304 - 30952189
Alignment:
| Q |
13 |
aatatcaaccaaactagagacggttctaaaaataatccactacataatataaaaattgttacaataggtgttccacaaacttggtcccttttcttgtggt |
112 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30952304 |
aatatcaaccaaacttga--cggttctaaaaataatccactacataatataaaaattgttacaataggtgttccacaaacttggtcccttttcttgtggt |
30952207 |
T |
 |
| Q |
113 |
ttaggtggtgaccaagtt |
130 |
Q |
| |
|
||||| ||||| |||||| |
|
|
| T |
30952206 |
ttaggcggtgatcaagtt |
30952189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 177 - 251
Target Start/End: Complemental strand, 30952142 - 30952068
Alignment:
| Q |
177 |
taatggactaatttagatctcgcaattcttcttagggattaaagtgaatttttgtcataaaaatattagaaaagt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30952142 |
taatggactaatttagatctcgcaattcttcttagggattaaagtgaatttttatcataaaaatattagaaaagt |
30952068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University