View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11201_high_34 (Length: 260)
Name: NF11201_high_34
Description: NF11201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11201_high_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 6 - 244
Target Start/End: Complemental strand, 449624 - 449386
Alignment:
| Q |
6 |
cagagttgggttttgccttgaaaatcaggtccaatcatgattaaccaagggcgatgttggtgttgggttgtgggtggtttgatgataaataagttgcgtt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
449624 |
cagagttgggttttgccttgaaaatcaggtccaatcatgattaaccaagggcgatgttggtgttgggttgtgggtggtttgatgataaataagttgtgtt |
449525 |
T |
|
| Q |
106 |
ttatgaggtaggtgacgtaatcaatgttgggatcaatgtcgtgattgaagagttgtttcgagaataaacgtggaaactttaagcgtaaatggttttgatg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
449524 |
ttatgaggtaggtgacgtaatcaatgttgggatcaatgtcgtgattgaagagttgttttgagaataaacgtggaaactttaagcgtaaatggttttgatg |
449425 |
T |
|
| Q |
206 |
gtagttaggcgggatagatgaagagcgccatgtggaaca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
449424 |
gtagttaggcgggatagatgaagagcgccatgtggaaca |
449386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 16011098 - 16011060
Alignment:
| Q |
176 |
tggaaactttaagcgtaaatggttttgatggtagttagg |
214 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
16011098 |
tggaagctttaagggtaaatggttttgatggtagttagg |
16011060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University