View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11201_high_37 (Length: 260)
Name: NF11201_high_37
Description: NF11201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11201_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 63 - 249
Target Start/End: Original strand, 37820862 - 37821048
Alignment:
| Q |
63 |
caacgagcctaacaacgaaactcaccaagtaatgagatattcaattgattttggtctctaattttctttcatagggtatattggcttctgggctttgctt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37820862 |
caacgagcctaacaacgaaactcaccaagtaatgagatattcaattgattttggtctctaattttctttcatagggtatattggcttctgggctttgctt |
37820961 |
T |
 |
| Q |
163 |
tgtcctgttagcttggtgtgtgggcatgaagggacccttgtatgtgtctgcttttaatcctctattgcttgtgcttgtggctttcat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37820962 |
tgtcctgttagcttggtgtgtgggcatgaagggacccttgtatgtgtctgcttttaatcctctattgcttgtgcttgtggctttcat |
37821048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 226
Target Start/End: Original strand, 37824810 - 37824907
Alignment:
| Q |
129 |
tttcatagggtatattggcttctgggctttgctttgtcctgttagcttggtgtgtgggcatgaagggacccttgtatgtgtctgcttttaatcctcta |
226 |
Q |
| |
|
||||| ||||||||||||| ||||| ||||||||||||||||| ||||||||| || |||||||||| | | |||||| ||||| ||||||||| |
|
|
| T |
37824810 |
tttcacagggtatattggcctctggtacatgctttgtcctgttagcatggtgtgtgcgcttgaagggacctctatttgtgtcggctttcaatcctcta |
37824907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University