View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11201_high_40 (Length: 251)
Name: NF11201_high_40
Description: NF11201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11201_high_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 233
Target Start/End: Complemental strand, 4349782 - 4349554
Alignment:
| Q |
11 |
cacagaagcaatggatatcatatgttactcaatcgggtcggttgttgcatgtcatgatgacaaagattcaccccgttggtaaagtctatcactttcgagc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
4349782 |
cacagaagcaatggatatcatatgttactcaatcgggtcggttgttgcatgtcatgatgacaaagattcaccctgttggtaaagtctatcactttcgtgc |
4349683 |
T |
|
| Q |
111 |
taagcgtcaaatggctgagagtttgggacagattgccaagttcaaacgtcgttttgggttagaaaatccagaggctagtgccagtg------caaatgca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
4349682 |
taagcgtcaaatggctgagagtttgggacagattgccaagttcaaacgtcgtttcgggttagaaaatccagaggctagtgccagtgccagtacaagtgca |
4349583 |
T |
|
| Q |
205 |
aatgctgttgagaaaaaatgatttttcct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4349582 |
aatgctgttgagaaaaaatgatttttcct |
4349554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 11 - 183
Target Start/End: Complemental strand, 4341944 - 4341772
Alignment:
| Q |
11 |
cacagaagcaatggatatcatatgttactcaatcgggtcggttgttgcatgtcatgatgacaaagattcaccccgttggtaaagtctatcactttcgagc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4341944 |
cacagaagcaatggatatcatatgttactcaatcgggtcggttgttgcatgtcatgatgacaaagattcaccccgttggtaaagtctatcactttcgagc |
4341845 |
T |
|
| Q |
111 |
taagcgtcaaatggctgagagtttgggacagattgccaagttcaaacgtcgttttgggttagaaaatccagag |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
4341844 |
taagcgtcaaatggctgagagtttgggacagattgccaagttcaaacgtcgtttcgggttagaaaatcaagag |
4341772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University