View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11201_low_31 (Length: 291)
Name: NF11201_low_31
Description: NF11201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11201_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 51578406 - 51578235
Alignment:
| Q |
1 |
atgcagtatctgttgcatcattctttgttgctgctgacaaaactatcttggcttgtgcaagaaaacaatccctactgctagaagagtctctgaaacaaga |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51578406 |
atgcagtatctgttgcgtcattctttgttgctgctgacaaaattatcttggcttgtgcaagaaaacaatccctactgctagaagaatctctgaaacaaga |
51578307 |
T |
|
| Q |
101 |
aagatgatatgcaggcagttgaatatcttgggtttcacaccccattcctatagcactgataatcaatcttag |
172 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51578306 |
aagatgttatgcaggcagttgaatatcttgggtttcacaccccattcctatagcactgataatcaatcttag |
51578235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 201 - 282
Target Start/End: Complemental strand, 51578206 - 51578125
Alignment:
| Q |
201 |
ctcaacaaaataatgtgcaatgactgataatcccaaccttggccatggtgagctactgagctattacaaaagcttttcttct |
282 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
51578206 |
ctcaacagaataatgtgcaatgagtgataatcccaaccttggtcatggtgagctaatgagctattacaaaagcttttcttct |
51578125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University