View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11201_low_33 (Length: 274)
Name: NF11201_low_33
Description: NF11201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11201_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 258
Target Start/End: Original strand, 44466426 - 44466673
Alignment:
| Q |
12 |
atgaacatgcctcaccgacatagcgtcaaactcgatcggtattttcaaactatactaactatagaaaacatggtccttatgcataaattgttcgaaaact |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44466426 |
atgaacatgcctcaccaacatagcgtcaaactcgattggtatttttaaactatactaactatagaaaacatggtccttatgcataaattgttcgaaaact |
44466525 |
T |
 |
| Q |
112 |
tacatttagaccattcaaatatggtga-nnnnnnnnncatgcatacttcatacatccaaactgatgttaggggttcaaagatccatccatggacattatg |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44466526 |
tacatttagaccattcaaatatggtgattttttttttcatgcatacttcatacatccaaactgatgttaggggttcaaagatccatccatggacattatg |
44466625 |
T |
 |
| Q |
211 |
tttcatctgcatatgattctagccaagagtgtgaaagatgtactaggt |
258 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44466626 |
tttcatctgcatatgattctaaccaagagtgtgaaagatgtactaggt |
44466673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University