View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11201_low_34 (Length: 270)

Name: NF11201_low_34
Description: NF11201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11201_low_34
NF11201_low_34
[»] chr4 (1 HSPs)
chr4 (15-227)||(10165354-10165575)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 15 - 227
Target Start/End: Original strand, 10165354 - 10165575
Alignment:
15 agttcatagaaatcgaattggtggcatggatctgaaaatttttgtttcacatgcatgagattatggaattagttttgtgaaaaaggggattagggttgat 114  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10165354 agttcatagaaatcgaattggtggcatggatctgaaaatttttggttcacatgcatgagattatggaattagttttgtgaaaaaggggattagggttgat 10165453  T
115 cggagaaagtatgaaaaattgca-------gatgaatgagcaaaggatgcgaaatgagaggaaggaaactacgtgttgtgatttcaagca--ataaggaa 205  Q
    |||||||||||||||||||||||       |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||  |||||| |    
10165454 cggagaaagtatgaaaaattgcagatgaatgatgaatgaggaaaggatgcgaaatgagaggaaggaaactacgtgttgtgatttcaagcaatataaggga 10165553  T
206 agttaagatttcgcgcgccata 227  Q
    ||||||||||||||||||||||    
10165554 agttaagatttcgcgcgccata 10165575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University