View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11201_low_34 (Length: 270)
Name: NF11201_low_34
Description: NF11201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11201_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 15 - 227
Target Start/End: Original strand, 10165354 - 10165575
Alignment:
| Q |
15 |
agttcatagaaatcgaattggtggcatggatctgaaaatttttgtttcacatgcatgagattatggaattagttttgtgaaaaaggggattagggttgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10165354 |
agttcatagaaatcgaattggtggcatggatctgaaaatttttggttcacatgcatgagattatggaattagttttgtgaaaaaggggattagggttgat |
10165453 |
T |
 |
| Q |
115 |
cggagaaagtatgaaaaattgca-------gatgaatgagcaaaggatgcgaaatgagaggaaggaaactacgtgttgtgatttcaagca--ataaggaa |
205 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
10165454 |
cggagaaagtatgaaaaattgcagatgaatgatgaatgaggaaaggatgcgaaatgagaggaaggaaactacgtgttgtgatttcaagcaatataaggga |
10165553 |
T |
 |
| Q |
206 |
agttaagatttcgcgcgccata |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
10165554 |
agttaagatttcgcgcgccata |
10165575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University