View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11201_low_40 (Length: 256)
Name: NF11201_low_40
Description: NF11201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11201_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 18 - 180
Target Start/End: Original strand, 17977222 - 17977379
Alignment:
| Q |
18 |
gatataaataggcaaataggtttgtaagacaccgactttgagagtgactcgtatatccaactaatcattgcgggtttatttattttttgagagaatcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17977222 |
gatataaataggcaaataggtttgtaagacaccgactttgagagtgactcgtatatccaactaatcattgcgggtttatttattttttgagagaatcatt |
17977321 |
T |
 |
| Q |
118 |
gcgggtttctctctctattggagtattttgttgttcttgtttccttgcgggtttgtagttata |
180 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| ||||||||||||||||||||| |||| |
|
|
| T |
17977322 |
gcgggtttctctctctat-----tattttgtagttcctgtttccttgcgggtttgtagctata |
17977379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University