View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11201_low_49 (Length: 229)
Name: NF11201_low_49
Description: NF11201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11201_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 64 - 210
Target Start/End: Original strand, 32241926 - 32242069
Alignment:
| Q |
64 |
aaaataaaaatatgatacaaaattaatggccatgagttgcttgctttatatgctaaagaactcgaaatgcttaaccacttaataattaccctccaaacac |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32241926 |
aaaataaaaatatgatacaaaattaatggccatgagtt---tgctttatatgataaagaactcgaaatgcttaaccacttaataattaccctccaaacac |
32242022 |
T |
 |
| Q |
164 |
taccaaaagttaatactttgtaatgcttaacctaaccacttaataat |
210 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32242023 |
taccaaaaactaatactttgtaatgcttaacctaaccacataataat |
32242069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 32241896 - 32241928
Alignment:
| Q |
1 |
tcttttaaaattagtcaaatgttgccatccaaa |
33 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
32241896 |
tcttttaaaattagtcaaatgttgccgtccaaa |
32241928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University