View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11203_high_8 (Length: 307)
Name: NF11203_high_8
Description: NF11203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11203_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 46557315 - 46557608
Alignment:
| Q |
1 |
tagaagtagtaaaagagagttattaaaaccgcatgcagaggaatgaatgaatgtttgatttaccttgcacatgagaggttgtaattgttgttcttctggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557315 |
tagaagtagtaaaagagagttattaaaaccgcatgcagaggaatgaatgaatgtttgatttaccttgcacatgagaggttgtaattgttgttcttctggt |
46557414 |
T |
 |
| Q |
101 |
ggtagaggtggtggtgcttcttgaacaactactagttcgggtcttgtttctgttgcttccattgggaagtgaaaagaaacaagagcgatgtttagaaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557415 |
ggtagaggtggtggtgcttcttgaacaactactagttcgggtcttgtttctgttgcttccattgggaagtgaaaagaaacaagagcgatgtttagaaaga |
46557514 |
T |
 |
| Q |
201 |
gaaagagaggaggttactaattaagaaca---aggctttaaggttaattttggtatataaaaggtgatcacgaagaagaatgggaggagaatat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557515 |
gaaagagaggaggttactaattaagaacaaggaggctttaaggttaattttggtatataaaaggtgatcacgaagaagaatgggaggagaatat |
46557608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University