View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11203_low_10 (Length: 266)
Name: NF11203_low_10
Description: NF11203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11203_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 27670767 - 27671028
Alignment:
| Q |
1 |
ttaatcactcatgatttgatttattatgcatttgcaagtaatattaaatattaatttattttactcatgagtgatattacttattttattctttaaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27670767 |
ttaatcactcatgatttgatttattatgcatttgcaagtaatattaaatattaatttattttactcatgaatgatattacttattttattctttaaaaca |
27670866 |
T |
 |
| Q |
101 |
agttgattatgctccctcnnnnnnntaaaat-ttgattatgttatatctctatggacaccaatagtcttttttaatatcctcgtacaatttggagacacc |
199 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27670867 |
agttgattatgctccctcaaaaaaaaaaaaagttgattatgttatgtctctatggacaccaatagtcttttttaatatcctcgtacaatttggagatacc |
27670966 |
T |
 |
| Q |
200 |
ataccacatgaaagtgactttcatgagcttcatccaatattactctcctcaattcatctcac |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27670967 |
ataccacatgaaagtgactttcatgagcttcatccaatattactctcctcaattcttctcac |
27671028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University