View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11204_high_6 (Length: 338)
Name: NF11204_high_6
Description: NF11204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11204_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 33757182 - 33756982
Alignment:
| Q |
1 |
aaagtggttcgaattggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgaggagtcgtatcgttgaaggatcgagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33757182 |
aaagtggttcgaattggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgaggagtcgtatcgttgaaggatcgagtg |
33757083 |
T |
|
| Q |
101 |
gtggctgtgattgtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataactaactttcacgg |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33757082 |
gtggttgtgattgtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataacaaactttcacgg |
33756983 |
T |
|
| Q |
201 |
c |
201 |
Q |
| |
|
| |
|
|
| T |
33756982 |
c |
33756982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University