View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11205_high_4 (Length: 334)
Name: NF11205_high_4
Description: NF11205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11205_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 128 - 314
Target Start/End: Original strand, 42025044 - 42025245
Alignment:
| Q |
128 |
aaaggaccacttaatttagaatagaggaaatatagtaacacctaagattt-atttaatatggcttgctattatgagcgacaagggtactgaaacttttca |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42025044 |
aaaggaccacttaatttagaatagaggaaatatagtaacacctaagattttatttaatacggcttgctattatgagcgacaagggtactaaaacttttca |
42025143 |
T |
|
| Q |
227 |
attttattaatcttcatcaaccacttaa--------------tagaattgataaaatatagcattaaactgtaaaaatggcaactgcaaaagaataaaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42025144 |
attttattaatcttcatcaaccacttaatagaattgataaggtagaattgataaaatatagctttaaactgtaaaaatggcaactacaaaagaataaaaa |
42025243 |
T |
|
| Q |
313 |
ta |
314 |
Q |
| |
|
|| |
|
|
| T |
42025244 |
ta |
42025245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 3 - 67
Target Start/End: Original strand, 42024921 - 42024985
Alignment:
| Q |
3 |
cacatcacgtatcacagaatgtcatcttcaaagagatcttctagtacagaaacaaaaaatccaag |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42024921 |
cacatcacgtatcacagaatgtcatcttcaaagagatcttctagcacagaaacaaaaaatccaag |
42024985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University