View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11206_high_6 (Length: 254)
Name: NF11206_high_6
Description: NF11206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11206_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 16 - 244
Target Start/End: Original strand, 52725877 - 52726105
Alignment:
| Q |
16 |
cacaattagctatagttagttttgtactttttgtgcttgagattcatgcacctgattaagtaaatgtcgttaaacatgtgcaatgatgagaaattagaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52725877 |
cacaattagctatagttagttttgtactttttgtgcttgagattcatgcacctgattaagtaaatgtcgttaaacatgtgcaatgatgagaaattagaga |
52725976 |
T |
 |
| Q |
116 |
tattgattgaatccaaccgaaatgatgatgatgataccctttaagagtgacaatcaaaatcttcatgcttggcccgccttgaaacaacttaaagtttcac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52725977 |
tattgattgaatccaaccgaaatgatgatgatgataccctttgagagtgacaatcaaaatcttcatgcttggcccgccttgaaacaacttaaagtttcac |
52726076 |
T |
 |
| Q |
216 |
gtcttagaaattatatgtgtgggtctctg |
244 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
52726077 |
gtcttagaaatcatatgtgtgggtctctg |
52726105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University