View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11207_high_33 (Length: 307)
Name: NF11207_high_33
Description: NF11207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11207_high_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 11 - 289
Target Start/End: Complemental strand, 39808890 - 39808627
Alignment:
| Q |
11 |
cagagaggacataagtatcaacgccagcaacatcaatgagctgtttgatgtaagtaatcattgtcttcgtgtcgctaactaccgaagaagtggaaccatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
39808890 |
cagagaggacataagtatcaacgccagcaacatcaatgagctgtttgatgtaagtaatcattgtcttcgtgttgctaacttccgaagaagtggaaccatc |
39808791 |
T |
|
| Q |
111 |
gaccttgttgtcatactcacaatggcctccagccataatttcttaagttgttgttgcggatgaatggaaaataataatcctgagaagtgtaaacatgcag |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39808790 |
gaccttgttgtcatagtcacaatggcctccagccataatttcttaagttgttgttgcggatgaatggaaaataataaacctgagaagtgtaaacatgcag |
39808691 |
T |
|
| Q |
211 |
cgcaactcagcataatacaacaagatcttctcgaccataaacatgtcgatgctgtattttgttctaagccaagtataac |
289 |
Q |
| |
|
|| | | || | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39808690 |
cg-----ctgtattttg----------ttctcgaccataaacatgtcgatgctgtattttgttctaagccaagtataac |
39808627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University