View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11207_high_37 (Length: 285)
Name: NF11207_high_37
Description: NF11207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11207_high_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 100 - 268
Target Start/End: Complemental strand, 12894785 - 12894626
Alignment:
| Q |
100 |
ttgagttagtttactttgctttagggttagtttggttaaaatatttatacagttagctagggtttagtttgggcctgggcatgtgttttgcatcctctcg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12894785 |
ttgagttagtttactttgctttagggttagtttggttaaaatatttatacagttagctaggggttagtttgggcctgggcatgtgttttgcatcctctcg |
12894686 |
T |
|
| Q |
200 |
cttgctatccagtttcaatacttttgttttcttaattctttttcttctagaggcttgttggttgttttt |
268 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12894685 |
cttgctat---------atacttttgttttcttaattctttttcttctagaggcttgttggttcttttt |
12894626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 12894880 - 12894846
Alignment:
| Q |
1 |
agggtttagtttgctagggtttactttgcttcttc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12894880 |
agggtttagtttgctagggtttactttgcttcttc |
12894846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University