View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11207_high_43 (Length: 253)
Name: NF11207_high_43
Description: NF11207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11207_high_43 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 38 - 253
Target Start/End: Original strand, 52992886 - 52993096
Alignment:
| Q |
38 |
cgagttttatgagcaaaagcaacggtttttatttgaatctcaataaaattaacaatttgaaaattggtcaactagtaaaccaacttaagtagtatgaaat |
137 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52992886 |
cgagttttatgagcaaacgcaacggcttttatttgaatctcaataaaattaacaatttgaaaattggtcaactagtaaaccaacttaagtagtatgaaat |
52992985 |
T |
|
| Q |
138 |
aataccctttcacatgtttgggaacaaaatagtactaaaacaatatattgtaaataaaatnnnnnnnttatagtattaagcaaatgaaattatacctgct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52992986 |
aataccctttcacatgtttgggaacaaaatagtactaaaacaatatatagtaaataaaa-----aaattatagtattaagcaaatgaaattatacctgct |
52993080 |
T |
|
| Q |
238 |
atgatgacaagaatgt |
253 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
52993081 |
atgatgacaagaatgt |
52993096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University