View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11207_high_47 (Length: 247)
Name: NF11207_high_47
Description: NF11207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11207_high_47 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 980468 - 980229
Alignment:
| Q |
1 |
gaggacttgaactttccacttctaggctaaagttttaaatcacttgcccgaagatcaaaaatccgcagctgagtctagtgccttttcaacaatgtatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
980468 |
gaggacttgaactttccacttctaggctaaagttttaaatcacttgcccgaagatcaaaaatccgcagctgagtctagtgccttttcaacaatgtatgct |
980369 |
T |
 |
| Q |
101 |
aatccatatgatgcaattggaaaagtatttggacctgagcgctcgggtcgtgttcgaggtttgggaattgggatatccccttctagaaagttcggaccag |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
980368 |
aatccatacgatgcaattggaaaagtatttggacctgagcgctcgggtcgtgttcgaggtttgggaattgggatatccccttctagaaagttcggaccag |
980269 |
T |
 |
| Q |
201 |
atgtctgtttaaaggtattcgaccaagatttttctctgtg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
980268 |
atgtctgtttaaaggtattcgaccaagatttttctttgtg |
980229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 27146582 - 27146425
Alignment:
| Q |
1 |
gaggacttgaactttccacttctaggctaaagttttaaatcacttgcccgaagatcaaaaatccgcagctgagtctagtgccttttcaacaatgtatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27146582 |
gaggacttgaactttccacttctaggctaaagttttaaatcacttgcccgaagatcaaaaatccgcagttgagtctagtgccttttcaacaatgtatgct |
27146483 |
T |
 |
| Q |
101 |
aatccatatgatgcaattggaaaagtatttggacctgagcgctcgggtcgtgttcgag |
158 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27146482 |
aatccatacgatgcaattggaaaagtatttggacctgagcgctcgggtcgtgttcgag |
27146425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University