View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11207_low_33 (Length: 316)
Name: NF11207_low_33
Description: NF11207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11207_low_33 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 287; Significance: 1e-161; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 18 - 316
Target Start/End: Original strand, 6410590 - 6410888
Alignment:
| Q |
18 |
tctccaaaccctggaattcacttatttcctgagatcgcaagttccgcagaaaacacacaccttctcagctcaagaatgaaccccaaactcattctaaccg |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6410590 |
tctccaaaccctggaattgacttatttcctgagatcgcaagttccgcagaaaacacacaccttctcagctcaagaatgaaccccaaactcattctaaccg |
6410689 |
T |
 |
| Q |
118 |
acagatgcataccagattatcctctcggtttattcttcactaatgagaatggttgcctcttgcaatggtatcctttgtttaaacctaataaacgattata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6410690 |
acagatgcataccagattatcctctcggtttattcttcacttatgagaatggttgcctcttgcgatggtatcctttgtttaaacctaataaacgattata |
6410789 |
T |
 |
| Q |
218 |
gcactgaaaccaaactttattcactttgttttgtgggattgcttgtgcatccttgctggatttgttggtttccgatatttgtgcattaaattcaactgc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6410790 |
gcactgaaaccaaactttattcactttgttttgtgggattgcttgtgcatccttgctggatttgttggtttccgatatttgtgcattaaattcaactgc |
6410888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 29 - 114
Target Start/End: Complemental strand, 6402583 - 6402502
Alignment:
| Q |
29 |
tggaattcacttatttcctgagatcgcaagttccgcagaaaacacacaccttctcagctcaagaatgaaccccaaactcattctaa |
114 |
Q |
| |
|
||||||||||| ||||||| || |||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6402583 |
tggaattcactaatttcctccgaaagcaagttcggcagaaaacac----cttcgcagctcaagaatgaaccccaaactcattctaa |
6402502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University