View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11207_low_34 (Length: 310)
Name: NF11207_low_34
Description: NF11207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11207_low_34 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 40 - 295
Target Start/End: Complemental strand, 34933655 - 34933409
Alignment:
| Q |
40 |
ctccaaggtatctatgtattttcattgcatgacagttttcgttcgtaatctcttgggttgaagcttcttataagtagaatgagaagaatttgttgaattt |
139 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34933655 |
ctccaacgtatctatgtattttcattgcatgatagttttcgttcgtaatctctagggttgaagcttcttataagtagaatgagaagaatttgt------- |
34933563 |
T |
|
| Q |
140 |
gtctctctagggttgcattgcatgacagttttcgtttgtatctctttcaatcatattttcataatcgttgcttcattcgcaaggtatctatgtattttca |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34933562 |
--ctctctagggttgcattgcatgacagttttcgtttgtatctctttcaatcatattttcataatcgttgcttcactcgcaaggtatctatgtattttca |
34933465 |
T |
|
| Q |
240 |
ttcttcttctttattttgtcaaaactcaagttgattatcatatatgtctctttctg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34933464 |
ttcttcttctttattttgtcaaaactcaagttgattatcatatatgtctctttctg |
34933409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 44 - 232
Target Start/End: Complemental strand, 34927146 - 34926958
Alignment:
| Q |
44 |
aaggtatctatgtattttcattgcatgacagttttcgttcgtaatctcttgggttgaagcttcttataagtagaatgagaagaatttgttgaatttgtct |
143 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
34927146 |
aaggtatctatgtaatttcattgcatgacagttttttttcgtaatctctagggttgaagcttcttatacgtagaatgagaagaatttgttgaacttgtct |
34927047 |
T |
|
| Q |
144 |
ctctagggttgcattgcatgacagttttcgtttgtatctctttcaatcatattttcataatcgttgcttcattcgcaaggtatctatgt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
34927046 |
ctctagggttgcattgcatgacagttttcgttcttatctctttcaatcttattttcatattcgttgcttcactctcaaggtatctatgt |
34926958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University