View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11207_low_47 (Length: 250)
Name: NF11207_low_47
Description: NF11207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11207_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 233
Target Start/End: Original strand, 44638569 - 44638807
Alignment:
| Q |
8 |
agagagaagaagcagtttctttgtcatgttaacttgatgaaacgcttatcttccggttcttatgtgcaaccaaccacccttcaacatcgagttcctccta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44638569 |
agagagaagaagcagtttctttgtcatgttaacttgatgaaacgcttatcttccagttcttatgtgcaaccaaccacccttcaacattgagttcctccta |
44638668 |
T |
 |
| Q |
108 |
ccagccaccatgtggcaaaatgcattgcaatttgcaacaagtatgtctattggagtgtgga-------------tttcacatttcccaccaagtcagcaa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44638669 |
ccagccaccatgtggcaaaatgcattgcaatttgcaacaagtatgtctattggagtgtggatttcacattcccttttcacatttcccaccaagtcagcaa |
44638768 |
T |
 |
| Q |
195 |
gaagcctacttgaaaatggatagaacagtggctacattt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44638769 |
gaagcctacttgaaaatggatagaacagtggctacattt |
44638807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University