View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11207_low_51 (Length: 246)
Name: NF11207_low_51
Description: NF11207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11207_low_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 62 - 236
Target Start/End: Original strand, 42603183 - 42603357
Alignment:
| Q |
62 |
atggttgtcactgagtggataacgtgaagctttcttcttttagatggttacaagcaaatattagtaaattaaattttgattttcattactggttgacaaa |
161 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42603183 |
atggttgtcactgggtggataacgtgaagctttcttcttttagatggttgcaagcaaatattagtaaattaaattttgattttcattactggttgacaaa |
42603282 |
T |
|
| Q |
162 |
tctcattgagtgttttaccatgcttcttagttagtgttttttctttatttagcttgatgtggtattggtcctttg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42603283 |
tctcattgagtgttttaccatgcttcttagttagtgttttttctttatttagcttgatgtggtattggtcctttg |
42603357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 53
Target Start/End: Original strand, 42603103 - 42603139
Alignment:
| Q |
17 |
acaaacaacaaccaaagcctcgtcacaattttacata |
53 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42603103 |
acaaacaaaaaccaaagcctcgtcacaattttacata |
42603139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 135 - 197
Target Start/End: Complemental strand, 30778402 - 30778340
Alignment:
| Q |
135 |
ttttgattttcattactggttgacaaatctcattgagtgttttaccatgcttcttagttagtg |
197 |
Q |
| |
|
||||||||||||| | ||| |||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
30778402 |
ttttgattttcatcatcggtggacaaatctcattgagtgttttaccatgattcctagttagtg |
30778340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 94 - 178
Target Start/End: Complemental strand, 17413827 - 17413743
Alignment:
| Q |
94 |
tcttcttttagatggttacaagcaaatattagtaaattaaattttgattttcattactggttgacaaatctcattgagtgtttta |
178 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||| |||| |||||||| || ||| || ||| ||||||||| ||||||||| |
|
|
| T |
17413827 |
tcttctttcatatggttacaagcaaatattagtaacttaacatttgatttggatcactagtggactaatctcatttagtgtttta |
17413743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 149
Target Start/End: Original strand, 28640412 - 28640476
Alignment:
| Q |
85 |
gtgaagctttcttcttttagatggttacaagcaaatattagtaaattaaattttgattttcatta |
149 |
Q |
| |
|
||||||||||| |||| || |||||||||||||| | |||||| |||| ||| ||||||||||| |
|
|
| T |
28640412 |
gtgaagctttcctcttgcaggtggttacaagcaaaaaatagtaacttaactttcgattttcatta |
28640476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University